snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD56
sequence
CCACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGAGACTCT
GGGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD56
alias U56
chromosome ⁄ contig 20
locus ⁄ host gene NOL5A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C517
accession no X96655,NT_011387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved