snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD86
sequence
GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTG
ATGGCCAGTCCTGGTGTCTGAGTGATT
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD86
alias U86
chromosome ⁄ contig 20
locus ⁄ host gene NOL5A
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_004399,NT_011387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved