snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA51
sequence
GGCCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGT
AGAGTAAACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAA
TGGGGGAACATAG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA51
alias ACA51
chromosome ⁄ contig 20
locus ⁄ host gene NOL5A
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002981 NT_011387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved