snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA12
sequence
AGTTGTGGTGGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGGGCCTAACTCTGC
CACATATATAATATCGGAGATGGCAAAGGCTTGTGACGGAGATATCTCTCTTAAGCCTTT
CCTGCATCAGAGAATGGCTCCCACATGT
  Box motif
  Complementary to target RNA
length 147
organism Homo_sapiens
snoRNA name SNORA12
alias U108
chromosome ⁄ contig 10
locus ⁄ host gene CWF19L1
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002954 NT_030059
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved