snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA37
sequence
TGAGCACTTTCACAGGTCCTCCCTCAGGCTGTGGGGCCAGGATTTGGTAGCTGGTGCTG
AGAGAAAACCTTTGTTGGCATCCTTGCCCTGGGACTGTGCCAGTGGCAGCTGTCATTCAA
TGGGACAATT
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA37
alias ACA37
chromosome ⁄ contig 18
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U4643
accession no AJ609444 NT_010966
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved