snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3L6
sequence
ATGGGCACAGTCTCATTGTTTCTATAGTTTATTACCAGAAAAGTTTCTCAGAATGTGTA
GAGCACTGGAAACCATGAGGAAGAGGCATAGCGTTCTCTCTTGAGCATCAAGTTGGCTGT
TGGTGTTGCTTTGCTGCAAACGCCATTTGTCATTGTCTTCCTTGTCTTCCTTTAGGAGAG
TAAGAGGGAGAGGACACAGTCTGGGTAG
  Box motif
  Complementary to target RNA
length 207
organism Homo_sapiens
snoRNA name SNORD3L6
alias
chromosome ⁄ contig 17
locus ⁄ host gene Mono:269:AC003043.1
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved