snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA25L5
sequence
AGGTCATTTCAAAGAGGTCTTGTGAGGCTGTGAAACCAAGAGCTCTTAACACTGCGACC
AAAGATGGAAGTTCTCTATAGGATGCCATGGCATTTGATGGTGCTATGTTTTCTTGAGGA
GATATAAGA
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA25L5
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:163:AC094019.2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved