snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA4L1
sequence
CTATCAAAAGTTACTTTTTGTGGGGTGGAAGTTTTTAAAATAACCTTTACCTACGTGGG
CTGTTTTGGAAAATAAAGAAAAGACCACACTCAGCAGAGGGCTATACCCCTTAGTATAGT
TCACCACTATTTTGCAGCTTATATT
  Box motif
  Complementary to target RNA
length 144
organism Homo_sapiens
snoRNA name SNORA4L1
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:191:AC004830.1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved