snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD78L2
sequence
ATGTAATAATGTTCATCAAATGTCTGACCTGAAATGAGCATGTAGACAAGTTAATTTAA
CACTGAAGAA
  Box motif
  Complementary to target RNA
length 69
organism Homo_sapiens
snoRNA name SNORD78L2
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:36:AC092630.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved