snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA11BL1
sequence
GGGGTGTGCTCAGAGCAGGGGGCTGAAGAATGGCTCCTCTGTTTATAACACATGGAACA
GGCATCTGAGGTCACTGTGACAAGGGGCACAAAACTTGTGACTCCCTAAGAACAAATGTC
CTACAAGT
  Box motif
  Complementary to target RNA
length 127
organism Homo_sapiens
snoRNA name SNORA11BL1
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:117:AC080089.5
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved