snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA2AL2
sequence
TAGGCCCTGAATCAAGACTAGTGTTTTGCTGTAGCTGTTGGTTTCAAACAGGATCCGAG
AGTGATGTCTTCCTTGTGGTCTGTTCACTGCTCAGTATCCCAGTGTCAGTGGCCAATTCA
GTTGGAAGCAACATGG
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA2AL2
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:25:AC007240.2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved