snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA13
sequence
AGCCTTTGTGTTGCCCATTCACTTTGGAAACTAGTGAATGTGGTGTCAAAAAAGGCGTA
AATTAAACGCTTTGCAGCCTTTTCCTGCCCTTAAATTTGATACCTTTGGTGTAGGAGCTG
CATAAGTAACAGTT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA13
alias ACA13
chromosome ⁄ contig 5
locus ⁄ host gene
organization intronic
target RNA
modification type H/ACA
modification site 18S:U1248
accession no AJ609455 NT_034772
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved