snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD113-1
sequence
AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAA
CTCTGAAGTCC
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD113-1
alias 14q(I-1)
chromosome ⁄ contig 14
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no NR_003229,NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved