snOPY snoRNA Orthological Gene Database
Homo_sapiens U3.41-201
sequence
AAGACTCCTTTCAGGAATCATTTCTTTAGTTCCTACTAGAGAGGCTTCTCTTAACATGT
GGAGCGCTGGAAACCACAAAGAGGAGGTGCAGCATTCAGTTCTAAGTGTGAAGTGGATTC
TTGGTGTTGCTGTGCTGCAACTGCCATTTGCTAATGATGACCTTGCTTTTCTTACTTAGA
GTAAGACAGAGAGACAGCAGTCAGCCTAAGCGGT
  Box motif
  Complementary to target RNA
length 213
organism Homo_sapiens
snoRNA name U3.41-201
alias
chromosome ⁄ contig 6
locus ⁄ host gene Mono:95:U3.41-201
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved