snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD89
sequence
ACTGAGGAATGATGACAAGAAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCT
CCATGGGCACACGATGACAAAATATCCTGAAGCGAACCACTAGTCTGACCTCAGT
  Box motif
  Complementary to target RNA
length 114
organism Homo_sapiens
snoRNA name SNORD89
alias HBII-289
chromosome ⁄ contig 2
locus ⁄ host gene Mono:40:AC013722.8
organization Mono
target RNA Unknown
modification type C/D
modification site
accession no NR_003070,NT_022171
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved