snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA51L12
sequence
GCCCGCCTTGGCCTCCCAAAGTGCTGGGATTCTTACATCGACTGCATAGAAAGAGGAGA
GAACATAACCTACCTACCCCGTACATACTTCAGCCCAGGTCCTGTGCCTCATCTGTAATA
TGAATGAAGAGACATGG
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORA51L12
alias
chromosome ⁄ contig 21
locus ⁄ host gene Mono:308:AF064863.3
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved