snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD81L4
sequence
CAGGTAAAACAGGCCTTTAGAACTATTATCCAGGACTCACTGATTACTTGATGACAATA
AAATATCTGATAGCCTA
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD81L4
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:252:AC018474.31
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved