snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA15
sequence
GCATGGCTGAATACTGTGTTCTTTTATCAGTAGTTTACACAGCCAGACACCATGCAAAA
GCAGTCTTCCCTTTAGAATGACTGATGGTATGCTAAGGTTTTTCATAGCATATCATTATT
AAAGGTGAATACAAAT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA15
alias
chromosome ⁄ contig 7
locus ⁄ host gene CCT6P1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1367
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved