snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA25L4
sequence
AGGTCATTTCAAAGAAGGTTCACGTGGCTGTGAGACCAAGAACGCTTAATGCTGTTACC
AAAGATTGCAATAGGTTGTGATAGCCCTCAGTAGTGCTATGTTCCTCTGGGGAGATATTA
AT
  Box motif
  Complementary to target RNA
length 121
organism Homo_sapiens
snoRNA name SNORA25L4
alias
chromosome ⁄ contig 13
locus ⁄ host gene Mono:158:AL138701.16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved