snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA40L5
sequence
TGGACTTATGCGTGCGTTTGTTTAACTTGTGGGCAAGTACTTATAGACAGGTGCAAACA
ATAAATCTCCTTTTGCAACTGAGAACTTGTTGTTCAGTATGAGTTTTGATACATATAAGA
AAGGCTATT
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA40L5
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:253:AC087893.15
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved