snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA9
sequence
TAGCAAGCCTCCAGCGTGCTTGGGTCTGCGGTGACCCTATGCATTCCTTCAGTGCTTGC
TAGAACAGTTTTGAAACGGTTTGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGA
AATTTCAGACAATG
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA9
alias ACA9
chromosome ⁄ contig 7
locus ⁄ host gene Mono:190:AC004847.3
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1670,28S:U1769
accession no AJ609431,NT_007819
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved