snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD113-5
sequence
TGGATCAATGATGAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCT
GTGTAACTCTGAGATCTG
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD113-5
alias 14q(I-5)
chromosome ⁄ contig 14
locus ⁄ host gene SNORD113@,SNORD114@
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved