snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD64
sequence
GGATTTGTGATGAGCTGTGTTTACTGAGCATGATGAAGTAAAGCTCAACGTGATTACTC
TGAAGTCC
  Box motif
  Complementary to target RNA
length 67
organism Homo_sapiens
snoRNA name SNORD64
alias HBII-13
chromosome ⁄ contig 15
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no NR_001294,NT_026446
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved