snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70L4
sequence
TAGAAGCCAATTAAGCCAACTGAGTTTCTTTCCTCACAGGGACCTGGTGTGCCATGGCT
GCAAACAGCAGCTTCCTTGTCAGGGTACGCAGACTGTTTCTTGGATGGGTTGCTCTAAGG
GACCTTGGAGACAGGC
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA70L4
alias
chromosome ⁄ contig 17
locus ⁄ host gene Mono:264:AC090287.9
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved