snOPY snoRNA Orthological Gene Database
Homo_sapiens AL160394.19
sequence
AGATAACTTCAAAGAGGGCTTGCGGAGCTGCAAAACCAAGAGCTTTTAATGTATTACTG
AATATTGAAGTTCTCCGTAGGATGCCATAGTCACTCAGTAGTGCTATATCTTCCTAAGCA
GATATAAGA
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name AL160394.19
alias
chromosome ⁄ contig 13
locus ⁄ host gene Mono:152:AL160394.19
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved