snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA25L14
sequence
TGGTTTAAAGCCAACTCTGGGCTCCCATCAGAAGGAAGGAGATGAATGCTATGACCAAA
GACTGAAGTTCTCTATAGAGTCCACAGCACTCAATAGTACTGTATTTTCCTGAGGAGATA
TAAGA
  Box motif
  Complementary to target RNA
length 124
organism Homo_sapiens
snoRNA name SNORA25L14
alias
chromosome ⁄ contig 10
locus ⁄ host gene Mono:15:AL365398.22
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved