snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118L8
sequence
TCATCAGGTGGGATAATCTTTTCCTGTTCTTCCTTTTGGAGGACAGATTATAACATGAT
TATTGGAGATGCAAGAAACATGATCAACATCTATACATAATCACGACTTGAAACATCCTG
ATTGCTCCTATCTCAT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORD118L8
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:248:AC090052.15
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved