snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA17
sequence
ACTGCCCCTAGAGGCGTTGCAGCTGTGGCTGCCGTGTCACATCTGTGTCATTAGGTGGC
AGAGATTAGAGAGGCTATGTCTACGCTCAGCGTTCTGCCCCGTGAACGTTTGAATGTTTG
ATAGTCTCACACT
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA17
alias ACA17
chromosome ⁄ contig 9
locus ⁄ host gene MGC16037
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4598,28S:U4659,28S:U4937
accession no AJ609434 NT_024000
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved