snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA51L9
sequence
GGCCTTTTGGTGCTTACCACAGACTGTGCTCTTTCACTGACTGAATAGAGAGAGGAGGC
AGAGTAAACCTATCCTATATACACCTCAGTCCAAGCCTGGTCTGTATTATGAATGGGGCA
ACATGG
  Box motif
  Complementary to target RNA
length 125
organism Homo_sapiens
snoRNA name SNORA51L9
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:237:AL713899.14
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved