snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@L8
sequence
AAGACTATACTTTGAGGGATCATTTCTATAGTTTGTTACTGGAGAAGTTTCTCTGAATA
TGTAGAGCACCACAAATCACGAGGAAAAAGCGCAGCATTCTCTCCTGAGCATGAAGCCAG
TTTTCAGTGTTGCTTCGATGTAACTGCCTTCTGCCCTTGATGATCATTCTTCTCTCCTCC
CTGGAGAGTAAGAGGGAGAGGAGGCAGTCTGAGTGG
  Box motif
  Complementary to target RNA
length 215
organism Homo_sapiens
snoRNA name SNORD3@L8
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:162:AC025614.12
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved