snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD81L2
sequence
TTGGATATACGATAATCTCACTCCGACTTAAACTCTCTCACTGATTATTTGATAATAAC
AGGTCAGATATTCTT
  Box motif
  Complementary to target RNA
length 74
organism Homo_sapiens
snoRNA name SNORD81L2
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:122:AC091857.3
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved