snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA27L1
sequence
AAACCCCTGTTCACTTTGCCAAATGGATTTGTGTCTTTATTGCTCATTAATTGGGGCAA
AGGAAATATCCTTTTAAAACTCAGGCAAACTGAGTGTTTGTCTTGTATCCTGTCAGAGGA
AAGAAAT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA27L1
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:133:AC116353.2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved