snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD112
sequence
TGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCAC
AAAACACTGAGGTCCATT
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD112
alias 14q(0)
chromosome ⁄ contig 14
locus ⁄ host gene MEG8
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_003080,NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved