snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD45CL1
sequence
GGTCAATGATGAGCTGACATGTATTCTGAATCTAAAGTTGATTATTAGTACTTTAGTTC
TAGAATTACTGAGACATG
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD45CL1
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:132:AC011399.6
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved