snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA9L4
sequence
GATCGATGATGAAAATAAGCAAGTTTGAGCATCAGAAGACCTTCCAGTCTACTTGATGC
ATGAGCTCTACAGTTTTAAGA
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SCARNA9L4
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:192:AC069285.8
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved