snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD93
sequence
TGGCCAAGGATGAGAACTCTAATCTGATTTTATGTGCTTCTGCTGTGATGGATTAAAGG
ATTTACCTGAGGCCA
  Box motif
  Complementary to target RNA
length 74
organism Homo_sapiens
snoRNA name SNORD93
alias HBII-336
chromosome ⁄ contig 7
locus ⁄ host gene Mono:184:AC005682.2
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A576
accession no NR_003075,NT_007819
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved