snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD115-3
sequence
GGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGC
TTAGTAGGATTACGCTGAGGCCT
  Box motif
  Complementary to target RNA
length 82
organism Homo_sapiens
snoRNA name SNORD115-3
alias HBII-52-3
chromosome ⁄ contig 15
locus ⁄ host gene SNORD115@
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved