snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD115-1
sequence
GTGTTGATGATGAGAACCTTATATTATCCTGAAGAGAGGTGATGACTTAAAAATCATGC
TCAATAGGATTACGCTGAGGCCC
  Box motif
  Complementary to target RNA
length 82
organism Homo_sapiens
snoRNA name SNORD115-1
alias HBII-52-1
chromosome ⁄ contig 15
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no NR_001291,NT_026446
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved