snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA33L1
sequence
GGACCCCATCTCAAAAAAAAAAAAAAAATTAAGCTGGTGATAGTAAAGCCATGTTATGA
GCTTTAAGGACATTGAAGTCATTAAGATTCCTGGAAATGGCTACAAAA
  Box motif
  Complementary to target RNA
length 107
organism Homo_sapiens
snoRNA name SNORA33L1
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:174:AC022296.34
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved