snOPY snoRNA Orthological Gene Database
Homo_sapiens AL161640.23
sequence
TTGTCAGGTGGGATAATCCTTACCTATGTTTGGAGGACAGTATTAGGACATAATGATTG
GAGTCACATGATATGATTAATGTCTGCTTCATAATCAGGTCTCACACACCCTGATTGCTC
CTATCTGAT
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name AL161640.23
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:238:AL161640.23
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved