snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA62L3
sequence
TATTCTTCTTGTTAGAGCTCGGAGTTGAGGCCAGTGACTGGCCAATGAACTCACAAGTG
TAGACAGGGTGTTACGCAAGGGACAAGTTTTTCACTAACACCACAAGAGTCTCTGGCCCA
ATGAGAGGAGTTTAATAGAAATTCTTGCTACAACT
  Box motif
  Complementary to target RNA
length 154
organism Homo_sapiens
snoRNA name SNORA62L3
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:284:AC009884.8
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved