snOPY snoRNA Orthological Gene Database
Homo_sapiens AC104012.11
sequence
TCCACAGGTGAGATCATCCTTACCTGTTCCTTCTTTTGGAGGGCAGAGTTCACGATGAC
TAGAGTTTACATGATATGTGATTAATTCTCTGCATAATCAGGATTTGCAACATTCTGTTT
GCTCCTACCTGAT
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name AC104012.11
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:296:AC104012.11
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved