snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD41L1
sequence
AGGGAAGTGATGACAACTGTGACTGTTGTGTGACACTGATTTCTCTCATATTTGTACTG
GCTGATCCTG
  Box motif
  Complementary to target RNA
length 69
organism Homo_sapiens
snoRNA name SNORD41L1
alias
chromosome ⁄ contig 14
locus ⁄ host gene Mono:272:AL135998.6
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved