snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA75L4
sequence
CAATTAAAATGACTACAGATTGGTGGCAGTTTATGGATTTGCACAAGAAGAGAGAACTC
ACAGAACTAGCATTATTTTACCCTCTGTCTTTACAGAGGTATATTTGGCTGTTTTGTTAG
ACATTC
  Box motif
  Complementary to target RNA
length 125
organism Homo_sapiens
snoRNA name SNORA75L4
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:240:AC009533.10
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved