snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD77L3
sequence
ATACTATGATGTTTGCATAGTTCAGCAGATTGAATTATGAAGAGATCTACCATTTGTCT
GGTGTT
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD77L3
alias
chromosome ⁄ contig 15
locus ⁄ host gene Mono:64:AC018515.7
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved