snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD60
sequence
AGTCTGTGATGAATTGCTTTGACTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCT
GATTATTTAGCAAGACTGAGGCTT
  Box motif
  Complementary to target RNA
length 83
organism Homo_sapiens
snoRNA name SNORD60
alias U60
chromosome ⁄ contig 16
locus ⁄ host gene AA974833
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4340
accession no X96660,NT_010393
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved