snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD56L5
sequence
CTACAATCATGGCAATATTTTTTGTCAACAGCGGTTCACCTAGTGAATGTTGATACTTT
GGGTTTGAGTGA
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD56L5
alias
chromosome ⁄ contig 14
locus ⁄ host gene Mono:278:AC005994.2
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved