snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70EL4
sequence
AAGAGAATAAATAGCACGACCAGAAATACGGAAAACACACAAAGACCCTTCAGCTGCAA
ACAACAGCTTCCTTGGTAGTTTATGCAGCCTGTTTCTTGTATGGGCTGCTCTAAGGGACC
ATGGAGACAGGC
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA70EL4
alias
chromosome ⁄ contig 16
locus ⁄ host gene Mono:150:AC007610.10
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved