snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA62L4
sequence
ATTGCACGTTGTTGGAGCTTGGAGTTGGTGCTCTAACTGGCTGATAAACTTGCAAGTGT
AGGTAGTATGCTATGTGAGGGGCAAATTTTTCAGTAACATGACAAAGGTCTTTGGCCTAG
TGAGTAGAGTTTGACAATAATCCTCGCTGCAAGT
  Box motif
  Complementary to target RNA
length 153
organism Homo_sapiens
snoRNA name SNORA62L4
alias
chromosome ⁄ contig 11
locus ⁄ host gene Mono:310:AC103710.2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved