snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD75L1
sequence
GGCCAGTGATGGTTTAAAAGTAATGGACAGAAGGTTTCTGAAATTCTATTTTGAAGTT
  Box motif
  Complementary to target RNA
length 58
organism Homo_sapiens
snoRNA name SNORD75L1
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:112:AC104701.5
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved